|
Thermo Fisher
trueguide synthetic sgrna crispr887531_sgm Trueguide Synthetic Sgrna Crispr887531 Sgm, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/trueguide synthetic sgrna crispr887531_sgm/product/Thermo Fisher Average 90 stars, based on 1 article reviews
trueguide synthetic sgrna crispr887531_sgm - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
invitrogen trueguide synthetic sgrnas Invitrogen Trueguide Synthetic Sgrnas, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/invitrogen trueguide synthetic sgrnas/product/Thermo Fisher Average 86 stars, based on 1 article reviews
invitrogen trueguide synthetic sgrnas - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
trueguide synthetic sgrna ![]() Trueguide Synthetic Sgrna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/trueguide synthetic sgrna/product/Thermo Fisher Average 90 stars, based on 1 article reviews
trueguide synthetic sgrna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
trueguide sgrna; a35534 ![]() Trueguide Sgrna; A35534, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/trueguide sgrna; a35534/product/Thermo Fisher Average 90 stars, based on 1 article reviews
trueguide sgrna; a35534 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
trueguide synthetic sgrna targeting tp53 (crispr718498_sgm) ![]() Trueguide Synthetic Sgrna Targeting Tp53 (Crispr718498 Sgm), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/trueguide synthetic sgrna targeting tp53 (crispr718498_sgm)/product/Thermo Fisher Average 90 stars, based on 1 article reviews
trueguide synthetic sgrna targeting tp53 (crispr718498_sgm) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
grna (ggttcccaaggacctatatg, trueguide™ cancers 2024, 16, 2489 4 of 14 synthetic sgrna) ![]() Grna (Ggttcccaaggacctatatg, Trueguide™ Cancers 2024, 16, 2489 4 Of 14 Synthetic Sgrna), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/grna (ggttcccaaggacctatatg, trueguide™ cancers 2024, 16, 2489 4 of 14 synthetic sgrna)/product/Thermo Fisher Average 90 stars, based on 1 article reviews
grna (ggttcccaaggacctatatg, trueguide™ cancers 2024, 16, 2489 4 of 14 synthetic sgrna) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
bach1 trueguide synthetic sgrna-2 (custom) ![]() Bach1 Trueguide Synthetic Sgrna 2 (Custom), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/bach1 trueguide synthetic sgrna-2 (custom)/product/Thermo Fisher Average 90 stars, based on 1 article reviews
bach1 trueguide synthetic sgrna-2 (custom) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
trueguide synthetic sgrna #a35533 ![]() Trueguide Synthetic Sgrna #A35533, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/trueguide synthetic sgrna #a35533/product/Thermo Fisher Average 90 stars, based on 1 article reviews
trueguide synthetic sgrna #a35533 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
trueguide modified synthetic sgrnas ![]() Trueguide Modified Synthetic Sgrnas, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/trueguide modified synthetic sgrnas/product/Thermo Fisher Average 90 stars, based on 1 article reviews
trueguide modified synthetic sgrnas - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
trueguide synthetic guide rna (sgrna) ![]() Trueguide Synthetic Guide Rna (Sgrna), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/trueguide synthetic guide rna (sgrna)/product/Thermo Fisher Average 90 stars, based on 1 article reviews
trueguide synthetic guide rna (sgrna) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
trueguide synthetic grnas crispr425134_sgm ![]() Trueguide Synthetic Grnas Crispr425134 Sgm, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/trueguide synthetic grnas crispr425134_sgm/product/Thermo Fisher Average 90 stars, based on 1 article reviews
trueguide synthetic grnas crispr425134_sgm - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
trueguide™ synthetic sgrna ![]() Trueguide™ Synthetic Sgrna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/trueguide™ synthetic sgrna/product/Thermo Fisher Average 90 stars, based on 1 article reviews
trueguide™ synthetic sgrna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: iScience
Article Title: Leveraging Vγ9Vδ2 T cells against prostate cancer through a VHH-based PSMA-Vδ2 bispecific T cell engager
doi: 10.1016/j.isci.2024.111289
Figure Lengend Snippet:
Article Snippet: For the generation of a LNCaP-derived PSMA knock-out cell line, LNCaP cells were co-transfected with four predesigned synthetic CRISPR guide RNAs (CRISPR646020_SGM, CRISPR971863_SGM, CRISPR646032_SGM and CRISPR646028_SGM, Thermo-Fisher Scientific) and the recombinant Streptococcus pyogenes Cas9 (wt) protein (Thermo-Fisher Scientific) using Lipofectamine (
Techniques: Blocking Assay, Control, Labeling, Recombinant, Software, FCAP Assay, Isolation, Cell Isolation, Modification
Journal: EMBO Molecular Medicine
Article Title: BMP-9 mediates fibroproliferation in fibrodysplasia ossificans progressiva through TGF-β signaling
doi: 10.1038/s44321-024-00174-3
Figure Lengend Snippet: Reagents and tools table
Article Snippet: Customized RNA was synthesized by
Techniques: Transgenic Assay, Recombinant, Cell Counting, Cell Cycle Assay, Binding Assay, Blocking Assay, Enzyme-linked Immunosorbent Assay, Luciferase, Reporter Assay, Western Blot, Reverse Transcription, Control, Software, Real-time Polymerase Chain Reaction
Journal: Communications Biology
Article Title: Deep genomic characterization highlights complexities and prognostic markers of pediatric acute myeloid leukemia
doi: 10.1038/s42003-023-04732-2
Figure Lengend Snippet: a Bubble plots showing significant biological processes positively (red) and negatively (blue) associated with TP53 alterations by GSEA. The color of the bubbles indicates the −log10 (FWER-adjusted P value). NES normalized enrichment score. b TP53 -altered AML cell lines are more BUB1B -dependent, aneuploid, and etoposide-resistant. Gene effect describes how vital a particular gene is when the gene is knocked down in a cell line. A more negative score implies that a cell line is more dependent on that gene. Boxes represent the interquartile ranges and the black line inside the boxes indicates the median. The whiskers show the maximum and minimum except for outliers (circles, more than 1.5 × interquartile range outside of the box) and extremes (asterisk, more than 3 × interquartile range distant). Data were obtained from the DepMap. P values were calculated by the Mann–Whitney U -test. c Confirmation of BUB1B and CIT knockdown by quantitative RT-PCR and immunoblotting after 72 h of siRNA (si) transfection. mRNA levels were normalized to GAPDH . Consistent immunoblotting results were obtained from two experiments. d Effects of BUB1B and CIT knockdown on THP-1 and MOLM-13 proliferation. After 72 h of siRNA transfection, cell proliferation was monitored by CellTiter-Glo assays (RLU) and trypan blue cell counting (Relative cell number). Proliferation was relative to the 72-h post-transfection time point. RLU relative luminescence. e BUB1B knockdown induced apoptosis. Representative flow cytometric analysis of propidium iodide-stained cells after 5 days of BUB1B knockdown. Consistent results were obtained from 4 independent experiments (sub-G1: 40.2, 33.4, 37.1, and 41.1% in THP-1; 4.2, 3.1, 7.0, and 8.6% in MOLM-13. t = 14.98, df = 6, P = 5.6 ×10 −6 by t -test). f BUB1B knockdown induced a pro-apoptotic gene expression signature. Quantitative RT-PCR analysis was performed after 5 days of siRNA transfection. Expression levels were relative to the negative siRNA group. g CRISPR/Cas9 disruption of TP53 in MOLM-13 cells. Two clones showing heterozygous disruptions of TP53 by fragment analysis and Sanger sequencing. h Quantitative RT-PCR indicates comparable BUB1B knockdown in the negative control and CRISPR clones. i Proliferation of the negative control and CRISPR clones after BUB1B knockdown was assessed by CellTiter-Glo assays. Proliferation was relative to the negative siRNA transfection. Data in charts ( c , d , f , h , i ) are expressed as mean ± SE from three independent experiments. The number of values used to calculate the statistics (one-way ANOVA followed by Dunnett’s test in d , f , h , i ) in each group is indicated. For the post hoc Dunnett’s test, the control category was the negative si group ( d , f ) and the negative control CRISPR clone ( i ).
Article Snippet: The
Techniques: MANN-WHITNEY, Quantitative RT-PCR, Western Blot, Transfection, Cell Counting, Staining, Expressing, CRISPR, Clone Assay, Sequencing, Negative Control
Journal: STAR Protocols
Article Title: Protocol to use RNaseH1-based CRISPR to modulate locus-associated R-loops
doi: 10.1016/j.xpro.2022.101734
Figure Lengend Snippet:
Article Snippet:
Techniques: Purification, Recombinant, Fluorescence, Protease Inhibitor, Extraction, Software, Hood, Microscopy, Real-time Polymerase Chain Reaction, Spectrophotometry
Journal: STAR Protocols
Article Title: Protocol to use RNaseH1-based CRISPR to modulate locus-associated R-loops
doi: 10.1016/j.xpro.2022.101734
Figure Lengend Snippet: Stock solutions and aliquots preparation
Article Snippet:
Techniques: Concentration Assay, Sterility, Blocking Assay, Protease Inhibitor
Journal: STAR Protocols
Article Title: Protocol to use RNaseH1-based CRISPR to modulate locus-associated R-loops
doi: 10.1016/j.xpro.2022.101734
Figure Lengend Snippet: Tube B
Article Snippet:
Techniques: Concentration Assay