trueguide synthetic sgrna Search Results


90
Thermo Fisher trueguide synthetic sgrna crispr887531_sgm
Trueguide Synthetic Sgrna Crispr887531 Sgm, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/trueguide synthetic sgrna crispr887531_sgm/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
trueguide synthetic sgrna crispr887531_sgm - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

86
Thermo Fisher invitrogen trueguide synthetic sgrnas
Invitrogen Trueguide Synthetic Sgrnas, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/invitrogen trueguide synthetic sgrnas/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
invitrogen trueguide synthetic sgrnas - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

90
Thermo Fisher trueguide synthetic sgrna

Trueguide Synthetic Sgrna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/trueguide synthetic sgrna/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
trueguide synthetic sgrna - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Thermo Fisher trueguide sgrna; a35534
Reagents and tools table
Trueguide Sgrna; A35534, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/trueguide sgrna; a35534/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
trueguide sgrna; a35534 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Thermo Fisher trueguide synthetic sgrna targeting tp53 (crispr718498_sgm)
a Bubble plots showing significant biological processes positively (red) and negatively (blue) associated with <t>TP53</t> alterations by GSEA. The color of the bubbles indicates the −log10 (FWER-adjusted P value). NES normalized enrichment score. b TP53 -altered AML cell lines are more BUB1B -dependent, aneuploid, and etoposide-resistant. Gene effect describes how vital a particular gene is when the gene is knocked down in a cell line. A more negative score implies that a cell line is more dependent on that gene. Boxes represent the interquartile ranges and the black line inside the boxes indicates the median. The whiskers show the maximum and minimum except for outliers (circles, more than 1.5 × interquartile range outside of the box) and extremes (asterisk, more than 3 × interquartile range distant). Data were obtained from the DepMap. P values were calculated by the Mann–Whitney U -test. c Confirmation of BUB1B and CIT knockdown by quantitative RT-PCR and immunoblotting after 72 h of siRNA (si) transfection. mRNA levels were normalized to GAPDH . Consistent immunoblotting results were obtained from two experiments. d Effects of BUB1B and CIT knockdown on THP-1 and MOLM-13 proliferation. After 72 h of siRNA transfection, cell proliferation was monitored by CellTiter-Glo assays (RLU) and trypan blue cell counting (Relative cell number). Proliferation was relative to the 72-h post-transfection time point. RLU relative luminescence. e BUB1B knockdown induced apoptosis. Representative flow cytometric analysis of propidium iodide-stained cells after 5 days of BUB1B knockdown. Consistent results were obtained from 4 independent experiments (sub-G1: 40.2, 33.4, 37.1, and 41.1% in THP-1; 4.2, 3.1, 7.0, and 8.6% in MOLM-13. t = 14.98, df = 6, P = 5.6 ×10 −6 by t -test). f BUB1B knockdown induced a pro-apoptotic gene expression signature. Quantitative RT-PCR analysis was performed after 5 days of siRNA transfection. Expression levels were relative to the negative siRNA group. g CRISPR/Cas9 disruption of TP53 in MOLM-13 cells. Two clones showing heterozygous disruptions of TP53 by fragment analysis and Sanger sequencing. h Quantitative RT-PCR indicates comparable BUB1B knockdown in the negative control and CRISPR clones. i Proliferation of the negative control and CRISPR clones after BUB1B knockdown was assessed by CellTiter-Glo assays. Proliferation was relative to the negative siRNA transfection. Data in charts ( c , d , f , h , i ) are expressed as mean ± SE from three independent experiments. The number of values used to calculate the statistics (one-way ANOVA followed by Dunnett’s test in d , f , h , i ) in each group is indicated. For the post hoc Dunnett’s test, the control category was the negative si group ( d , f ) and the negative control CRISPR clone ( i ).
Trueguide Synthetic Sgrna Targeting Tp53 (Crispr718498 Sgm), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/trueguide synthetic sgrna targeting tp53 (crispr718498_sgm)/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
trueguide synthetic sgrna targeting tp53 (crispr718498_sgm) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Thermo Fisher grna (ggttcccaaggacctatatg, trueguide™ cancers 2024, 16, 2489 4 of 14 synthetic sgrna)
a Bubble plots showing significant biological processes positively (red) and negatively (blue) associated with <t>TP53</t> alterations by GSEA. The color of the bubbles indicates the −log10 (FWER-adjusted P value). NES normalized enrichment score. b TP53 -altered AML cell lines are more BUB1B -dependent, aneuploid, and etoposide-resistant. Gene effect describes how vital a particular gene is when the gene is knocked down in a cell line. A more negative score implies that a cell line is more dependent on that gene. Boxes represent the interquartile ranges and the black line inside the boxes indicates the median. The whiskers show the maximum and minimum except for outliers (circles, more than 1.5 × interquartile range outside of the box) and extremes (asterisk, more than 3 × interquartile range distant). Data were obtained from the DepMap. P values were calculated by the Mann–Whitney U -test. c Confirmation of BUB1B and CIT knockdown by quantitative RT-PCR and immunoblotting after 72 h of siRNA (si) transfection. mRNA levels were normalized to GAPDH . Consistent immunoblotting results were obtained from two experiments. d Effects of BUB1B and CIT knockdown on THP-1 and MOLM-13 proliferation. After 72 h of siRNA transfection, cell proliferation was monitored by CellTiter-Glo assays (RLU) and trypan blue cell counting (Relative cell number). Proliferation was relative to the 72-h post-transfection time point. RLU relative luminescence. e BUB1B knockdown induced apoptosis. Representative flow cytometric analysis of propidium iodide-stained cells after 5 days of BUB1B knockdown. Consistent results were obtained from 4 independent experiments (sub-G1: 40.2, 33.4, 37.1, and 41.1% in THP-1; 4.2, 3.1, 7.0, and 8.6% in MOLM-13. t = 14.98, df = 6, P = 5.6 ×10 −6 by t -test). f BUB1B knockdown induced a pro-apoptotic gene expression signature. Quantitative RT-PCR analysis was performed after 5 days of siRNA transfection. Expression levels were relative to the negative siRNA group. g CRISPR/Cas9 disruption of TP53 in MOLM-13 cells. Two clones showing heterozygous disruptions of TP53 by fragment analysis and Sanger sequencing. h Quantitative RT-PCR indicates comparable BUB1B knockdown in the negative control and CRISPR clones. i Proliferation of the negative control and CRISPR clones after BUB1B knockdown was assessed by CellTiter-Glo assays. Proliferation was relative to the negative siRNA transfection. Data in charts ( c , d , f , h , i ) are expressed as mean ± SE from three independent experiments. The number of values used to calculate the statistics (one-way ANOVA followed by Dunnett’s test in d , f , h , i ) in each group is indicated. For the post hoc Dunnett’s test, the control category was the negative si group ( d , f ) and the negative control CRISPR clone ( i ).
Grna (Ggttcccaaggacctatatg, Trueguide™ Cancers 2024, 16, 2489 4 Of 14 Synthetic Sgrna), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna (ggttcccaaggacctatatg, trueguide™ cancers 2024, 16, 2489 4 of 14 synthetic sgrna)/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
grna (ggttcccaaggacctatatg, trueguide™ cancers 2024, 16, 2489 4 of 14 synthetic sgrna) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Thermo Fisher bach1 trueguide synthetic sgrna-2 (custom)
a Bubble plots showing significant biological processes positively (red) and negatively (blue) associated with <t>TP53</t> alterations by GSEA. The color of the bubbles indicates the −log10 (FWER-adjusted P value). NES normalized enrichment score. b TP53 -altered AML cell lines are more BUB1B -dependent, aneuploid, and etoposide-resistant. Gene effect describes how vital a particular gene is when the gene is knocked down in a cell line. A more negative score implies that a cell line is more dependent on that gene. Boxes represent the interquartile ranges and the black line inside the boxes indicates the median. The whiskers show the maximum and minimum except for outliers (circles, more than 1.5 × interquartile range outside of the box) and extremes (asterisk, more than 3 × interquartile range distant). Data were obtained from the DepMap. P values were calculated by the Mann–Whitney U -test. c Confirmation of BUB1B and CIT knockdown by quantitative RT-PCR and immunoblotting after 72 h of siRNA (si) transfection. mRNA levels were normalized to GAPDH . Consistent immunoblotting results were obtained from two experiments. d Effects of BUB1B and CIT knockdown on THP-1 and MOLM-13 proliferation. After 72 h of siRNA transfection, cell proliferation was monitored by CellTiter-Glo assays (RLU) and trypan blue cell counting (Relative cell number). Proliferation was relative to the 72-h post-transfection time point. RLU relative luminescence. e BUB1B knockdown induced apoptosis. Representative flow cytometric analysis of propidium iodide-stained cells after 5 days of BUB1B knockdown. Consistent results were obtained from 4 independent experiments (sub-G1: 40.2, 33.4, 37.1, and 41.1% in THP-1; 4.2, 3.1, 7.0, and 8.6% in MOLM-13. t = 14.98, df = 6, P = 5.6 ×10 −6 by t -test). f BUB1B knockdown induced a pro-apoptotic gene expression signature. Quantitative RT-PCR analysis was performed after 5 days of siRNA transfection. Expression levels were relative to the negative siRNA group. g CRISPR/Cas9 disruption of TP53 in MOLM-13 cells. Two clones showing heterozygous disruptions of TP53 by fragment analysis and Sanger sequencing. h Quantitative RT-PCR indicates comparable BUB1B knockdown in the negative control and CRISPR clones. i Proliferation of the negative control and CRISPR clones after BUB1B knockdown was assessed by CellTiter-Glo assays. Proliferation was relative to the negative siRNA transfection. Data in charts ( c , d , f , h , i ) are expressed as mean ± SE from three independent experiments. The number of values used to calculate the statistics (one-way ANOVA followed by Dunnett’s test in d , f , h , i ) in each group is indicated. For the post hoc Dunnett’s test, the control category was the negative si group ( d , f ) and the negative control CRISPR clone ( i ).
Bach1 Trueguide Synthetic Sgrna 2 (Custom), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bach1 trueguide synthetic sgrna-2 (custom)/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
bach1 trueguide synthetic sgrna-2 (custom) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Thermo Fisher trueguide synthetic sgrna #a35533
a Bubble plots showing significant biological processes positively (red) and negatively (blue) associated with <t>TP53</t> alterations by GSEA. The color of the bubbles indicates the −log10 (FWER-adjusted P value). NES normalized enrichment score. b TP53 -altered AML cell lines are more BUB1B -dependent, aneuploid, and etoposide-resistant. Gene effect describes how vital a particular gene is when the gene is knocked down in a cell line. A more negative score implies that a cell line is more dependent on that gene. Boxes represent the interquartile ranges and the black line inside the boxes indicates the median. The whiskers show the maximum and minimum except for outliers (circles, more than 1.5 × interquartile range outside of the box) and extremes (asterisk, more than 3 × interquartile range distant). Data were obtained from the DepMap. P values were calculated by the Mann–Whitney U -test. c Confirmation of BUB1B and CIT knockdown by quantitative RT-PCR and immunoblotting after 72 h of siRNA (si) transfection. mRNA levels were normalized to GAPDH . Consistent immunoblotting results were obtained from two experiments. d Effects of BUB1B and CIT knockdown on THP-1 and MOLM-13 proliferation. After 72 h of siRNA transfection, cell proliferation was monitored by CellTiter-Glo assays (RLU) and trypan blue cell counting (Relative cell number). Proliferation was relative to the 72-h post-transfection time point. RLU relative luminescence. e BUB1B knockdown induced apoptosis. Representative flow cytometric analysis of propidium iodide-stained cells after 5 days of BUB1B knockdown. Consistent results were obtained from 4 independent experiments (sub-G1: 40.2, 33.4, 37.1, and 41.1% in THP-1; 4.2, 3.1, 7.0, and 8.6% in MOLM-13. t = 14.98, df = 6, P = 5.6 ×10 −6 by t -test). f BUB1B knockdown induced a pro-apoptotic gene expression signature. Quantitative RT-PCR analysis was performed after 5 days of siRNA transfection. Expression levels were relative to the negative siRNA group. g CRISPR/Cas9 disruption of TP53 in MOLM-13 cells. Two clones showing heterozygous disruptions of TP53 by fragment analysis and Sanger sequencing. h Quantitative RT-PCR indicates comparable BUB1B knockdown in the negative control and CRISPR clones. i Proliferation of the negative control and CRISPR clones after BUB1B knockdown was assessed by CellTiter-Glo assays. Proliferation was relative to the negative siRNA transfection. Data in charts ( c , d , f , h , i ) are expressed as mean ± SE from three independent experiments. The number of values used to calculate the statistics (one-way ANOVA followed by Dunnett’s test in d , f , h , i ) in each group is indicated. For the post hoc Dunnett’s test, the control category was the negative si group ( d , f ) and the negative control CRISPR clone ( i ).
Trueguide Synthetic Sgrna #A35533, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/trueguide synthetic sgrna #a35533/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
trueguide synthetic sgrna #a35533 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Thermo Fisher trueguide modified synthetic sgrnas
a Bubble plots showing significant biological processes positively (red) and negatively (blue) associated with <t>TP53</t> alterations by GSEA. The color of the bubbles indicates the −log10 (FWER-adjusted P value). NES normalized enrichment score. b TP53 -altered AML cell lines are more BUB1B -dependent, aneuploid, and etoposide-resistant. Gene effect describes how vital a particular gene is when the gene is knocked down in a cell line. A more negative score implies that a cell line is more dependent on that gene. Boxes represent the interquartile ranges and the black line inside the boxes indicates the median. The whiskers show the maximum and minimum except for outliers (circles, more than 1.5 × interquartile range outside of the box) and extremes (asterisk, more than 3 × interquartile range distant). Data were obtained from the DepMap. P values were calculated by the Mann–Whitney U -test. c Confirmation of BUB1B and CIT knockdown by quantitative RT-PCR and immunoblotting after 72 h of siRNA (si) transfection. mRNA levels were normalized to GAPDH . Consistent immunoblotting results were obtained from two experiments. d Effects of BUB1B and CIT knockdown on THP-1 and MOLM-13 proliferation. After 72 h of siRNA transfection, cell proliferation was monitored by CellTiter-Glo assays (RLU) and trypan blue cell counting (Relative cell number). Proliferation was relative to the 72-h post-transfection time point. RLU relative luminescence. e BUB1B knockdown induced apoptosis. Representative flow cytometric analysis of propidium iodide-stained cells after 5 days of BUB1B knockdown. Consistent results were obtained from 4 independent experiments (sub-G1: 40.2, 33.4, 37.1, and 41.1% in THP-1; 4.2, 3.1, 7.0, and 8.6% in MOLM-13. t = 14.98, df = 6, P = 5.6 ×10 −6 by t -test). f BUB1B knockdown induced a pro-apoptotic gene expression signature. Quantitative RT-PCR analysis was performed after 5 days of siRNA transfection. Expression levels were relative to the negative siRNA group. g CRISPR/Cas9 disruption of TP53 in MOLM-13 cells. Two clones showing heterozygous disruptions of TP53 by fragment analysis and Sanger sequencing. h Quantitative RT-PCR indicates comparable BUB1B knockdown in the negative control and CRISPR clones. i Proliferation of the negative control and CRISPR clones after BUB1B knockdown was assessed by CellTiter-Glo assays. Proliferation was relative to the negative siRNA transfection. Data in charts ( c , d , f , h , i ) are expressed as mean ± SE from three independent experiments. The number of values used to calculate the statistics (one-way ANOVA followed by Dunnett’s test in d , f , h , i ) in each group is indicated. For the post hoc Dunnett’s test, the control category was the negative si group ( d , f ) and the negative control CRISPR clone ( i ).
Trueguide Modified Synthetic Sgrnas, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/trueguide modified synthetic sgrnas/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
trueguide modified synthetic sgrnas - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Thermo Fisher trueguide synthetic guide rna (sgrna)

Trueguide Synthetic Guide Rna (Sgrna), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/trueguide synthetic guide rna (sgrna)/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
trueguide synthetic guide rna (sgrna) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Thermo Fisher trueguide synthetic grnas crispr425134_sgm

Trueguide Synthetic Grnas Crispr425134 Sgm, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/trueguide synthetic grnas crispr425134_sgm/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
trueguide synthetic grnas crispr425134_sgm - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Thermo Fisher trueguide™ synthetic sgrna

Trueguide™ Synthetic Sgrna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/trueguide™ synthetic sgrna/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
trueguide™ synthetic sgrna - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Journal: iScience

Article Title: Leveraging Vγ9Vδ2 T cells against prostate cancer through a VHH-based PSMA-Vδ2 bispecific T cell engager

doi: 10.1016/j.isci.2024.111289

Figure Lengend Snippet:

Article Snippet: For the generation of a LNCaP-derived PSMA knock-out cell line, LNCaP cells were co-transfected with four predesigned synthetic CRISPR guide RNAs (CRISPR646020_SGM, CRISPR971863_SGM, CRISPR646032_SGM and CRISPR646028_SGM, Thermo-Fisher Scientific) and the recombinant Streptococcus pyogenes Cas9 (wt) protein (Thermo-Fisher Scientific) using Lipofectamine (Thermo-Fisher Scientific), according to manufacturer’s recommendations (TrueGuide Synthetic sgRNA).

Techniques: Blocking Assay, Control, Labeling, Recombinant, Software, FCAP Assay, Isolation, Cell Isolation, Modification

Reagents and tools table

Journal: EMBO Molecular Medicine

Article Title: BMP-9 mediates fibroproliferation in fibrodysplasia ossificans progressiva through TGF-β signaling

doi: 10.1038/s44321-024-00174-3

Figure Lengend Snippet: Reagents and tools table

Article Snippet: Customized RNA was synthesized by Invitrogen (TrueGuide sgRNA; A35534 ).

Techniques: Transgenic Assay, Recombinant, Cell Counting, Cell Cycle Assay, Binding Assay, Blocking Assay, Enzyme-linked Immunosorbent Assay, Luciferase, Reporter Assay, Western Blot, Reverse Transcription, Control, Software, Real-time Polymerase Chain Reaction

a Bubble plots showing significant biological processes positively (red) and negatively (blue) associated with TP53 alterations by GSEA. The color of the bubbles indicates the −log10 (FWER-adjusted P value). NES normalized enrichment score. b TP53 -altered AML cell lines are more BUB1B -dependent, aneuploid, and etoposide-resistant. Gene effect describes how vital a particular gene is when the gene is knocked down in a cell line. A more negative score implies that a cell line is more dependent on that gene. Boxes represent the interquartile ranges and the black line inside the boxes indicates the median. The whiskers show the maximum and minimum except for outliers (circles, more than 1.5 × interquartile range outside of the box) and extremes (asterisk, more than 3 × interquartile range distant). Data were obtained from the DepMap. P values were calculated by the Mann–Whitney U -test. c Confirmation of BUB1B and CIT knockdown by quantitative RT-PCR and immunoblotting after 72 h of siRNA (si) transfection. mRNA levels were normalized to GAPDH . Consistent immunoblotting results were obtained from two experiments. d Effects of BUB1B and CIT knockdown on THP-1 and MOLM-13 proliferation. After 72 h of siRNA transfection, cell proliferation was monitored by CellTiter-Glo assays (RLU) and trypan blue cell counting (Relative cell number). Proliferation was relative to the 72-h post-transfection time point. RLU relative luminescence. e BUB1B knockdown induced apoptosis. Representative flow cytometric analysis of propidium iodide-stained cells after 5 days of BUB1B knockdown. Consistent results were obtained from 4 independent experiments (sub-G1: 40.2, 33.4, 37.1, and 41.1% in THP-1; 4.2, 3.1, 7.0, and 8.6% in MOLM-13. t = 14.98, df = 6, P = 5.6 ×10 −6 by t -test). f BUB1B knockdown induced a pro-apoptotic gene expression signature. Quantitative RT-PCR analysis was performed after 5 days of siRNA transfection. Expression levels were relative to the negative siRNA group. g CRISPR/Cas9 disruption of TP53 in MOLM-13 cells. Two clones showing heterozygous disruptions of TP53 by fragment analysis and Sanger sequencing. h Quantitative RT-PCR indicates comparable BUB1B knockdown in the negative control and CRISPR clones. i Proliferation of the negative control and CRISPR clones after BUB1B knockdown was assessed by CellTiter-Glo assays. Proliferation was relative to the negative siRNA transfection. Data in charts ( c , d , f , h , i ) are expressed as mean ± SE from three independent experiments. The number of values used to calculate the statistics (one-way ANOVA followed by Dunnett’s test in d , f , h , i ) in each group is indicated. For the post hoc Dunnett’s test, the control category was the negative si group ( d , f ) and the negative control CRISPR clone ( i ).

Journal: Communications Biology

Article Title: Deep genomic characterization highlights complexities and prognostic markers of pediatric acute myeloid leukemia

doi: 10.1038/s42003-023-04732-2

Figure Lengend Snippet: a Bubble plots showing significant biological processes positively (red) and negatively (blue) associated with TP53 alterations by GSEA. The color of the bubbles indicates the −log10 (FWER-adjusted P value). NES normalized enrichment score. b TP53 -altered AML cell lines are more BUB1B -dependent, aneuploid, and etoposide-resistant. Gene effect describes how vital a particular gene is when the gene is knocked down in a cell line. A more negative score implies that a cell line is more dependent on that gene. Boxes represent the interquartile ranges and the black line inside the boxes indicates the median. The whiskers show the maximum and minimum except for outliers (circles, more than 1.5 × interquartile range outside of the box) and extremes (asterisk, more than 3 × interquartile range distant). Data were obtained from the DepMap. P values were calculated by the Mann–Whitney U -test. c Confirmation of BUB1B and CIT knockdown by quantitative RT-PCR and immunoblotting after 72 h of siRNA (si) transfection. mRNA levels were normalized to GAPDH . Consistent immunoblotting results were obtained from two experiments. d Effects of BUB1B and CIT knockdown on THP-1 and MOLM-13 proliferation. After 72 h of siRNA transfection, cell proliferation was monitored by CellTiter-Glo assays (RLU) and trypan blue cell counting (Relative cell number). Proliferation was relative to the 72-h post-transfection time point. RLU relative luminescence. e BUB1B knockdown induced apoptosis. Representative flow cytometric analysis of propidium iodide-stained cells after 5 days of BUB1B knockdown. Consistent results were obtained from 4 independent experiments (sub-G1: 40.2, 33.4, 37.1, and 41.1% in THP-1; 4.2, 3.1, 7.0, and 8.6% in MOLM-13. t = 14.98, df = 6, P = 5.6 ×10 −6 by t -test). f BUB1B knockdown induced a pro-apoptotic gene expression signature. Quantitative RT-PCR analysis was performed after 5 days of siRNA transfection. Expression levels were relative to the negative siRNA group. g CRISPR/Cas9 disruption of TP53 in MOLM-13 cells. Two clones showing heterozygous disruptions of TP53 by fragment analysis and Sanger sequencing. h Quantitative RT-PCR indicates comparable BUB1B knockdown in the negative control and CRISPR clones. i Proliferation of the negative control and CRISPR clones after BUB1B knockdown was assessed by CellTiter-Glo assays. Proliferation was relative to the negative siRNA transfection. Data in charts ( c , d , f , h , i ) are expressed as mean ± SE from three independent experiments. The number of values used to calculate the statistics (one-way ANOVA followed by Dunnett’s test in d , f , h , i ) in each group is indicated. For the post hoc Dunnett’s test, the control category was the negative si group ( d , f ) and the negative control CRISPR clone ( i ).

Article Snippet: The TrueGuide Synthetic sgRNA targeting TP53 (CRISPR718498_SGM) (Thermo Fisher Scientific) and TrueCut Cas9 Protein v2 (Thermo Fisher Scientific) were used to generate a ribonucleoprotein complex according to the manufacturer’s instructions.

Techniques: MANN-WHITNEY, Quantitative RT-PCR, Western Blot, Transfection, Cell Counting, Staining, Expressing, CRISPR, Clone Assay, Sequencing, Negative Control

Journal: STAR Protocols

Article Title: Protocol to use RNaseH1-based CRISPR to modulate locus-associated R-loops

doi: 10.1016/j.xpro.2022.101734

Figure Lengend Snippet:

Article Snippet: TrueGuide synthetic guide RNA (sgRNA) , Thermo Fisher Scientific , Link.

Techniques: Purification, Recombinant, Fluorescence, Protease Inhibitor, Extraction, Software, Hood, Microscopy, Real-time Polymerase Chain Reaction, Spectrophotometry

Stock solutions and aliquots preparation

Journal: STAR Protocols

Article Title: Protocol to use RNaseH1-based CRISPR to modulate locus-associated R-loops

doi: 10.1016/j.xpro.2022.101734

Figure Lengend Snippet: Stock solutions and aliquots preparation

Article Snippet: TrueGuide synthetic guide RNA (sgRNA) , Thermo Fisher Scientific , Link.

Techniques: Concentration Assay, Sterility, Blocking Assay, Protease Inhibitor

Tube B

Journal: STAR Protocols

Article Title: Protocol to use RNaseH1-based CRISPR to modulate locus-associated R-loops

doi: 10.1016/j.xpro.2022.101734

Figure Lengend Snippet: Tube B

Article Snippet: TrueGuide synthetic guide RNA (sgRNA) , Thermo Fisher Scientific , Link.

Techniques: Concentration Assay